Candida albicans (Robin) Berkhout (ATCC? 90028?)
Strain Designations: NCCLS 11 / Product Format: freeze-dried
Deposited As
Candida albicans (Robin) Berkhout, anamorph
Strain Designations
NCCLS 11
Application
Produces collagenase
Susceptibility disc testing
Susceptibility testing
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing.
Biosafety Level 1
Product Format freeze-dried
Storage Conditions
Frozen: -80℃ or colder
Freeze-Dried: 2℃ to 8℃
Live Culture: See Propagation Section
Type Strain no
Preceptrol? yes
Comments
Effect of amphotericin B on vitality
Fluconazole-sensitive
Multilocus genotyping
For additional infromation, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Morphology
After 2 days on YM agar at 30℃, colonies white, smooth, butyrous. Cells globose to ovoidal, single or in pairs, pseudohyphae not observed.
Medium
ATCC? Medium 200: YM agar or YM broth
ATCC? Medium 1245: YEPD
ATCC? Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 30℃ to 35℃
Atmosphere: Typical aerobic
Squenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
AAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTCTTTGAAACAAACTTGCTTTGGCGGTGGGCCCAGCCTGCCGCCAGAGGTCTAAACTTACAACCAATTTTTTATCAACTTGTCACACCAGATTATTACTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTTGAGCGTCGTTTCTCCCTCAAACCGCTGGGTTTGGTGTTGAGCAATACGACTTGGGTTTGCTTGAAAGACGGTAGTGGTAAGGCGGGATCGCTTTGACAATGGCTTAGGTCTAACCAAAAACATTGCTTGCGGCGGTAACGTCCACCACGTATATCTTCAAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG
D1D2 region of the 28S ribosomal RNA gene
GCGACTTAAGATCATTATGCCAACATCCTAGGTAAAAACCGCAGTCCTCGGTCTAGGCTGGCAGTATCGTCAGAGGCTATAACACACAGCAGAAGCCGTGCCACATTCCTCCGCCATTATCCTGCCGCTCCAAACCGATGCTGGCCCGGTAAACCGCAGCGGCCGCCCCCGAGAGAGCAGCATGCAAAATACCAAGTCTGATCTCAAGCCCTTCCCTTTCAACAATTTCACGTACTTTTTCACTCTCTTTTCAAAGTTCTTTTCATCTTTCCATCACTGTACTTGTTCGCTATCGGTCTCTCGCCAATATTTAGCTTTAGATGGAATTTACCACCCACTTAGAGCTGCATTCCCAAACAACTCGACTCGTCGAAGGAACTTTACACAGACCCGGGTCATCTCATCGCACGGGATTCTCACCCTCTGTGACGTCCTGTTCCAAGGAACATAGACAAGAGCCGGGCCCAAAGATACCTTCTTCAAATTACAACTCGGACGCCAAAGACGCCAGATTTCAAATTTGAGCTTTTGCCGCTTCACTCGCCGCTACTGAGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGC
Morphology
After 2 days on YM agar at 30℃, colonies white, smooth, butyrous. Cells globose to ovoidal, single or in pairs, pseudohyphae not observed.
Name of Depositor
MA Pfaller
Isolation
Blood, Iowa
Cross References
Nucleotide (GenBank) : AX109678 Sequence 411 from Patent WO0123604.
Nucleotide (GenBank) : AB006854 Candida albicans gene for CYP51 variant1, complete cds.
References
Espinel-Ingroff A, et al. Collaborative comparison of broth macrodilution and microdilution antifungal susceptibility tests. J Clin Microbiol 30: 3138-3145, 1992. PubMed: 1452697
Pfaller MA, et al. Selection of candidate quality control isolates and tentative quality control ranges for in vitro susceptibility testing of yeast isolates by National Committee for Clinical Laboratory Standards proposed standard methods. J Clin Microbiol 32: 1650-1653, 1994. PubMed: 7929752
Espinel-Ingroff A, et al. Comparison of two alternative microdilution procedures with the National Committee for Clinical Laboratory Standards reference macrodilution method M27-P for in vitro testing of fluconazole-resistant and -susceptible isolates of Candida albicans. J Clin Microbiol 33: 3154-3158, 1995. PubMed: 8586692
Liao RS, et al. Assessment of the effect of amphotericin B on the vitality of Candida albicans. Antimicrob. Agents Chemother. 43: 1034-1041, 1999. PubMed: 10223911
Luu LN, et al. Multilocus genotyping indicates that the ability to invade the bloodstream is widespread among Candida albicans isolates. J. Clin. Microbiol. 39: 1657-1660, 2001. PubMed: 11283111
Yang HC, et al. Extrusion of fluorescein diacetate by multidrug-resistant Candida albicans. Mycoses 44: 368-374, 2001. PubMed: 11766100
Hatano K, et al. Antifungal mechanism of FK463 against Candida albicans and Aspergillus fumigatus. J. Antibiot. 55: 219-222, 2002. PubMed: 12003006
Nishimura M, et al. Cell-associated collagenolytic activity by Candida albicans. Mycopathologia 153: 125-128, 2001.
Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.
Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002